Revista de Divulgación Científico-Tecnológica del Gobierno del Estado de Morelos

Las secuencias de ADN y analogías con los lenguajes

Dr. Joaquín Sánchez Castillo / Esta dirección de correo electrónico está protegida contra spambots. Usted necesita tener Javascript activado para poder verla.
Facultad de Medicina-UAEM

Archivo: Ciencias Genómicas

Como es prácticamente conocido por todos nosotros, la información genética (información que llevan nuestros genes) en plantas, animales y humanos está contenida en una molécula cuyo nombre abreviado es ya a todos familiar: ADN (o DNA en inglés) y cuyas siglas en español derivan de Ácido DesoxirriboNucléico (letras relevantes en mayúsculas y en cursiva). El ADN es un polímero (hecho de piezas individuales o monómeros) compuesto de 4 nucleótidos cuyos nombre se abrevian con las letras A (derivado de Adenina), C (Citosina), G (Guanina) y T (Timina). Así, una forma muy condensada de representar una molécula de ADN sería por ejemplo: GACTGGATGCTCCAGGATATA, donde cada letra simboliza un nucleótido. A este tipo de moléculas se les llama también secuencias de ADN, porque las 4 letras aparecen en sucesión, o secuencialmente como ocurre con las letras que forman cada palabra de este texto.

Las secuencias de ADN son una especie de texto de instrucciones, ya que del orden de las letras A, C, G, T depende el orden de otros polímeros en nuestras células. Es decir, la secuencia de ADN es interpretada por la célula para la construcción de otros polímeros, los cuales son cruciales para las funciones celulares. En concreto, la secuencia de ADN, a través de una molécula intermediaria relacionada en composición llamada ARN (Ácido RiboNucléico), determina la secuencia de las llamadas proteínas. Los monómeros que forman a las proteínas son llamados aminoácidos, pero los aminoácidos son 5 veces más numerosos que los nucleótidos; es decir, hay 20 aminoácidos diferentes. Las secuencias de ADN (mediante el ARN) definen cuales de los 20 aminoácidos se usarán para la proteína y también cuál será su orden o secuencia. La composición y orden de los aminoácidos en las proteínas es fundamental para sus propias características, de manera que la secuencia de aminoácidos de la proteína Mioglobina, que transporta oxígeno en nuestros músculos, es muy distinta a la secuencia de aminoácidos de la proteína Rodopsina en nuestros ojos, que nos sirve para detectar la luz. Aunque, hay también no pocos casos en los cuales proteínas de secuencia de aminoácidos distintas tienen funciones muy semejantes.

En la actualidad es de mucha importancia saber los detalles de las secuencias de ADN y del proceso de formación de proteínas al cual, dicho sea de paso, le llamamos traducción (con ARN como intermediario), como para los lenguajes, y en éste sentido la analogía es muy válida ya que las “letras” que forman al ADN (y al ARN) son distintas a las “letras” que forman a las proteínas, así que sería como traducir de un lenguaje a otro.

Al estar en la base de lo que sería una columna de información, el estudio de las secuencias de ADN es especialmente significativo y por ello los científicos se dieron a la tarea de determinar la secuencia de ADN del genoma humano. Es decir, han determinado el orden de los nucleótidos A, C, G y T (un total aproximado de tres mil millones de nucleótidos) y con ello en principio ya podríamos deducir cual es la secuencia de todas las proteínas que componen a nuestras células. Pero, aún cuando la secuencia del genoma nos ha acercado mucho a ese punto, no estamos allí todavía, ya que la célula tiene mecanismos muy sofisticados, que a menudo incluyen, por ejemplo, un tipo de edición de las secuencias intermedias de ARN, lo cual en no pocas ocasiones impide predecir con precisión la secuencia proteica basándose sólo en la secuencia de ADN.

Mi interés en los años recientes ha sido el análisis de las secuencias de ADN y en particular el investigar cómo es que secuencias de ADN que a pesar de ser específicas para la misma proteína pueden tener un ordenamiento de los nucleótidos A, C, G y T distinto. Esta flexibilidad en contenido se debe a los detalles del proceso de traducción. Primero, sabemos que los cuatro nucleótidos en el ADN no son interpretados de manera individual sino que son “leídos” o interpretados en grupos de tres, es decir en forma de palabras formadas por tríadas o tripletes. A esos tripletes se les conoce más comúnmente como codones (palabra derivada de código). Así, la información para colocar cada uno de los 20 aminoácidos en las proteínas depende de los codones. Por ejemplo el codón ATG define la presencia del aminoácido Metionina, mientras el codón TGG define la presencia del aminoácido Triptofano. Por lo tanto, la secuencia de ADN escrita arriba se leería como una serie de 7 codones:


I) GAC_TGG_ATG_CTC_CAG_GAT_ATA

y la secuencia correspondiente de 7 aminoácidos (cada aminoácido se simboliza con tres letras derivadas de su nombre) sería:

Asp_Trp_Met_Leu_Gln_Asp_Ile

Pero, ocurre que este proceso de traducción de ADN a proteína es un poco más complicado pues si bien Metionina y Triptofano requieren de un solo codón, todos los otros 18 aminoácidos son definidos por al menos 2 y hasta por 6 diferentes codones. Ello sería igual a decir que existen codones que son equivalentes. O, continuando con la analogía con los lenguajes, que en el ADN hay más de una palabra que significa lo mismo, es decir que hay sinónimos. De hecho, a los codones que definen el mismo aminoácido se les ha nombrado precisamente codones sinónimos.
Así, si hiciésemos uso de codones sinónimos podríamos significar la misma secuencia de aminoácidos:


Asp_Trp_Met_Leu_Gln_Asp_Ile

mediante la nueva secuencia de ADN:

II) GAT_TGG_ATG_CTG_CAA_GAC_ATC


Esta secuencia de ADN es totalmente equivalente a la secuencia (I) escrita arriba pues el orden y tipo de aminoácidos es idéntico.
Si se comparan las secuencias de ADN (I) y (II) con detenimiento se hace evidente que los codones tienen parecido, es decir las primeras dos letras o nucleótidos de cada codón o triplete son idénticas pero no así el tercer nucleótido. Claro, con la excepción de los codones para Triptofano y Metionina, que como se mencionó arriba no tienen codones sinónimos. Este parecido entre los codones sinónimos ocurre muy frecuentemente, aunque no es una regla absoluta.

Mis investigaciones actuales (teóricas) son sobre el ordenamiento de los codones sinónimos en los genes humanos y en los genes de otros organismos, pero les presentaré los detalles de mi trabajo en una contribución futura.


El Dr. Sánchez Castillo nació en H.H. Cuautla, Morelos. Estudió la carrera de Biología en la Universidad Autónoma del Estado de Morelos, obtuvo los grados de Maestro en Ciencias en la Facultad de Química de la UNAM y el grado de Doctor (Doctor of Philosophy, PhD) en la Universidad de Bristol en Inglaterra. Ha realizado estancias posdoctorales y sabáticas en la Universidad de Texas (UTHSC), en la Universidad de Gotemburgo, Suecia y en el Instituto de Investigaciones Biomédicas de la UNAM. Fue Director de Área en el Instituto Nacional de Salud Pública (SSa, México), miembro fundador electo de la Academia de Ciencias de Morelos en 1993, y recibió la presea estatal Cecilio A. Robelo de Ciencias en 1997. El Dr. Sánchez Castillo ha publicado 41 artículos en revistas internacionales indexadas y 2 capítulos de libros y sus trabajos han recibido 600 citaciones. Cabe señalar que, esta colaboración fue publicada en el periódico La Unión de Morelos dentro de la sección de ciencia de la Academia de Ciencias de Morelos. Es Investigador Nacional nivel II y actualmente es Profesor-Investigador Titular “C” definitivo de la Facultad de Medicina de la UAEM, asimismo, es integrante de la H. Junta de Gobierno de la misma Universidad.